Your privacy, your choice

We use essential cookies to make sure the site can function. We also use optional cookies for advertising, personalisation of content, usage analysis, and social media.

By accepting optional cookies, you consent to the processing of your personal data - including transfers to third parties. Some third parties are outside of the European Economic Area, with varying standards of data protection.

See our privacy policy for more information on the use of your personal data.

for further information and to change your choices.

Skip to main content

Table 3 Methylation-Specific PCR Primer Sequences

From: E2F2(E2F transcription factor 2) as a potential therapeutic target in meibomian gland carcinoma: evidence from functional and epigenetic studies

Gene Name

Forward(5′➝3′)

Reverse(5′➝3′)

Methylated E2F2

GTATTTAGGTGTTGTGTGGTTTAGC

ACCATAATCACTAAAAATCCTCGTA

Unmethylated E2F2

ATTTAGGTGTTGTGTGGTTTAGTGT

CCATAATCACTAAAAATCCTCATA